Basic Statistics
| Measure | Value |
|---|---|
| Filename | JX-3_S3_L004_R2_001.trim.paired.fastq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 111351891 |
| Total Bases | 16.6 Gbp |
| Sequences flagged as poor quality | 0 |
| Sequence length | 50-151 |
| %GC | 54 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG | 411522 | 0.3695689370915129 | No Hit |
| CTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGGCAT | 178795 | 0.16056754707470572 | No Hit |
| CGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGG | 145501 | 0.1306677405235983 | No Hit |
| CGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCT | 130125 | 0.11685926375511665 | No Hit |